View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16714_high_26 (Length: 293)
Name: NF16714_high_26
Description: NF16714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16714_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 14 - 163
Target Start/End: Complemental strand, 39947566 - 39947417
Alignment:
| Q |
14 |
tgagatgaagggacatagttacatggatgtgtatgtgttgcttcaaaagaaactgatcaaagtatgtcactgataaataagctgtgcatagcttgaatcc |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39947566 |
tgagttgaagggacatagttacatggatgtgtatgtgttgcttcaaaagaaactgatcaaagtatgtcactgataaataagctgtgcatagcttgaatcc |
39947467 |
T |
 |
| Q |
114 |
aagtttttcccttgtctgattcaaaagatttagaacttccattaattagc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
39947466 |
aagtttttcccttgtctgattcaaaagattataaactttcattaattagc |
39947417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 215 - 272
Target Start/End: Complemental strand, 39947362 - 39947305
Alignment:
| Q |
215 |
gtggtcaatggcattaacacgtatgttgttgaaatggacaaggcctatggttgagttg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39947362 |
gtggtcaatggcattaacacgtatgttgttgaaatggacaaggcctatggttgagttg |
39947305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University