View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16714_high_27 (Length: 292)
Name: NF16714_high_27
Description: NF16714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16714_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 100 - 280
Target Start/End: Complemental strand, 37831277 - 37831097
Alignment:
| Q |
100 |
aatgctagcatcagttactttacaatacaattcactgtacgtaagctcgtctttgctttcatccattcctgcctgcccattcgtcgttccttattttgga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37831277 |
aatgctagcatcagttactttacaatacaattcactgtacgtaagctcgtctttgctttcatccattcctgcctgcccattcgtcattccttattttgga |
37831178 |
T |
|
| Q |
200 |
gcatatgtttagataacgaaaacaaatggcaaaatgataatatacaaagaaattcaagcttattcaaattacgtttgtgat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37831177 |
gcatatgtttagataacgaaaacaaatggcaaaatgataatatacaaagaaattaaagcttattcaaattacgtttgtgat |
37831097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 37831453 - 37831376
Alignment:
| Q |
1 |
gaaattatccgtactctctttcatgtccttgttgatattcatttgtacagttcaccgtttatgaaaatgatgagttac |
78 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
37831453 |
gaaattttccatactctctttcatgtccttgttgaaattcatttgtacagtacaccgtttatgaaaatgaagagttac |
37831376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University