View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16714_high_30 (Length: 248)
Name: NF16714_high_30
Description: NF16714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16714_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 35 - 211
Target Start/End: Complemental strand, 6925487 - 6925312
Alignment:
| Q |
35 |
tgttaatcttggagtgcccgatctctttctcatgtcccgaaaggaaatattgatgcaaaaatgaactgacaaannnnnnngtgcattccattcaaataac |
134 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
6925487 |
tgttaatcttggagtgtccgatctctttctcatgtcc-gaaaggaaatattgatgcaaaaatgaactgacaaatttttgtgtgcattccattcaaatacc |
6925389 |
T |
 |
| Q |
135 |
aaatcagatgcataagcataatggtgatagaaataattgttagaatataacaatgttgatattattgtagtttatct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6925388 |
aaatcagatgcataagcataatggtgatagaaataattgttagaatataacaatgttgatattattgtagtttatct |
6925312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 209
Target Start/End: Complemental strand, 8368913 - 8368855
Alignment:
| Q |
151 |
cataatggtgatagaaataattgttagaatataacaatgttgatattattgtagtttat |
209 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| ||||||| || |||||||| |
|
|
| T |
8368913 |
cataacggtgatagaaataatcgttagaatataacaaatttgatatctttctagtttat |
8368855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University