View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16714_high_31 (Length: 243)
Name: NF16714_high_31
Description: NF16714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16714_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 37831655 - 37831430
Alignment:
| Q |
16 |
gacaaagctatctatcaagttaagagttttggatttgaagttcattcacgagtgaagcaaa---------tgaacttgtactatgagatacaaatgccac |
106 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37831655 |
gacaaagctatatatcaagttaagagttttggatttgaagttcattcacgagtgaagcaaaaactgcaaatgaacttgtactatgagatacaaatgccac |
37831556 |
T |
 |
| Q |
107 |
ataaattccatggctggattgctcaacaatttttactttttcaggatgtagtatattagtggtgcaaaggcaacggataatggtacacctaatctaatta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37831555 |
ataaattccatggctggattgctcaacaatttttactttttcaggatgtagtatattagtggtgcaaaggcaacggataatggtacacctaatctaatta |
37831456 |
T |
 |
| Q |
207 |
ttgaaattatccgtactctctttcat |
232 |
Q |
| |
|
|||||||| ||| ||||||||||||| |
|
|
| T |
37831455 |
ttgaaattttccatactctctttcat |
37831430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University