View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16714_low_41 (Length: 204)
Name: NF16714_low_41
Description: NF16714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16714_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 40405488 - 40405660
Alignment:
| Q |
18 |
gttgtgaagattggaaccgattccaatcgtgcaggtggaggtgctggtagcaaagtctgattttaacatgggatccatgaccgggnnnnnnnnnnnnnnn |
117 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40405488 |
gttgtgaagattggaacagatcccaatcgtgcaggtggaggtgccggtagcaaagtctgattttaacatgggatccatgaccgggaaaataaaaattgaa |
40405587 |
T |
 |
| Q |
118 |
nnnnnnnnnntcttaacctaaactttcaatttcatataatattgtaaaatgcaagaagggtgcttagtctctg |
190 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40405588 |
aaagaaaaaatcttaacctaaactatcaatttcatataatattgtaaaatgcaagaagggtgcttagtctctg |
40405660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University