View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16715_low_6 (Length: 382)
Name: NF16715_low_6
Description: NF16715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16715_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 250 - 366
Target Start/End: Original strand, 14776910 - 14777026
Alignment:
| Q |
250 |
aaagacaagatgataaaagtgtttgaaatgattttatggtgattttggtgaagaaggaataaaaagttgaaaggcaattgcaagaaactaattgatagct |
349 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||| |
|
|
| T |
14776910 |
aaagacaagatgataaaagtgattgtaatgattttatggtgattttggtgaagaaggaataaaaagttgaaagacaattgcaagaaacaaattcatagct |
14777009 |
T |
 |
| Q |
350 |
caattgaaaattgaaat |
366 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14777010 |
caattgaaaattgaaat |
14777026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University