View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16716_high_3 (Length: 251)
Name: NF16716_high_3
Description: NF16716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16716_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 10076474 - 10076254
Alignment:
| Q |
18 |
ataaatagttgacacatttcatcaacaaagcacaaatcaaatacatctcttaactatccaaactataataactttgtgaattcctaatatataatacaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
10076474 |
ataaatagttgacacatttcatcaaccaagcacaaatcaaatacatctcttaattatccaaactataa---ctttgtgaattcctaatatataacacaaa |
10076378 |
T |
|
| Q |
118 |
catgggtgtttttactcgttcaatggtgacattttgtgtgttgatatgtcttattggcatagtctcagcttcaagtgtaactccttcagcaactacttat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10076377 |
catgggtgtttttactcgttcaatggtgacattttgtgtgttgatatgtcttattggcatagtctcagcttcaagtgtaattccttcagcaactacttat |
10076278 |
T |
|
| Q |
218 |
gtgtctaatttgatctctgctcct |
241 |
Q |
| |
|
||||||||||||||| ||| |||| |
|
|
| T |
10076277 |
gtgtctaatttgatccctggtcct |
10076254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 143 - 215
Target Start/End: Complemental strand, 10084599 - 10084527
Alignment:
| Q |
143 |
gtgacattttgtgtgttgatatgtcttattggcatagtctcagcttcaagtgtaactccttcagcaactactt |
215 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
10084599 |
gtgatattttgtgtaatgatatgtcttattggcatagtttcagcttcaaatgtaattccttcagcaactactt |
10084527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University