View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16717_high_12 (Length: 292)
Name: NF16717_high_12
Description: NF16717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16717_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 17 - 276
Target Start/End: Complemental strand, 37982449 - 37982190
Alignment:
| Q |
17 |
tctcatgtttgtatgataaagtactatgattgagttatttgaatttatgatatttgttttaattgatcctcaacacgctggatatgcgcttagtaatatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37982449 |
tctcatgtttgtatgataaagtactatgattgagttatttgaatttatgatatttgttttaatttatcctcaacacgctgaatatgcgcttagtaatatc |
37982350 |
T |
 |
| Q |
117 |
aaatttacgcagttactaattgagcatataataatgcattaaccatgtcataaaacatactatcaaattaccaagcagcggatgcgttgtgaaacgattg |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37982349 |
aaatttacgtagttactaattgagcatataataatgcattaaccatgtcataaaacatactatcaaattaccaagcggcggatgcgttgtgaaacgattg |
37982250 |
T |
 |
| Q |
217 |
aaaatgtgcttagcaacattaaacatacacactcagtataggagcataaaacaaagaact |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
37982249 |
aaaatgtgcttagcaacattaaacatacacagtcagtattggagcataaaacaaagaact |
37982190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University