View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16717_high_15 (Length: 256)
Name: NF16717_high_15
Description: NF16717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16717_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 246
Target Start/End: Original strand, 28145682 - 28145911
Alignment:
| Q |
17 |
aaatgcaaatgtttacactgatactatgatgcaacaagagaagctagcaaagattgatttataaaaggctctgaatatggaagaagttttgtgaatggga |
116 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28145682 |
aaatgcaaatggttacactgatactttgatgcaacaagagaagctagcaaagattgatttataaaaggctctgaatatggaagaagttttgcgaatggga |
28145781 |
T |
 |
| Q |
117 |
tagaaacactattttattttcaataaaactgctcaaattacgcaagattataagaagatagtttcactaaatattgaagacagagtcatcactgatccag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28145782 |
tagaaacactattttattttcaataaaactgctcaaattatgcaagattataagaagatagtttcactaaatattaaagacagagtcatcactgatccag |
28145881 |
T |
 |
| Q |
217 |
aatagattaaaagtcatatggtttctcatt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28145882 |
aatagattaaaagtcatatggtttctcatt |
28145911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University