View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16717_high_20 (Length: 237)

Name: NF16717_high_20
Description: NF16717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16717_high_20
NF16717_high_20
[»] chr2 (2 HSPs)
chr2 (1-222)||(33138534-33138755)
chr2 (90-128)||(18558754-18558792)
[»] chr3 (4 HSPs)
chr3 (11-196)||(17664498-17664677)
chr3 (18-196)||(19246908-19247080)
chr3 (79-181)||(899746-899848)
chr3 (74-138)||(23331908-23331972)
[»] chr1 (19 HSPs)
chr1 (79-166)||(34309437-34309524)
chr1 (97-181)||(35212039-35212123)
chr1 (79-148)||(35190469-35190538)
chr1 (80-148)||(35270542-35270610)
chr1 (79-181)||(35295849-35295951)
chr1 (79-148)||(35276640-35276709)
chr1 (86-146)||(35205017-35205077)
chr1 (81-181)||(35224986-35225086)
chr1 (79-181)||(45525540-45525639)
chr1 (79-181)||(45531638-45531740)
chr1 (79-132)||(35147477-35147530)
chr1 (79-132)||(35263133-35263186)
chr1 (97-181)||(35194566-35194650)
chr1 (99-170)||(8638985-8639056)
chr1 (89-146)||(35476410-35476467)
chr1 (79-152)||(35189413-35189486)
chr1 (79-148)||(35200038-35200107)
chr1 (79-146)||(35248378-35248445)
chr1 (98-148)||(35208239-35208289)
[»] chr7 (1 HSPs)
chr7 (78-181)||(38631957-38632060)


Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 33138534 - 33138755
Alignment:
Q  1 tggtgaccgtagaagcgttaaatccgtttgtttggatccagacttggaacattggcggaagtggcactgcaatgaagaaggattgcagcgtcctactgtg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||    
T  33138534 tggtgaccgtagaagcgttaaatccgtttgtttggatccagacttggaacattggcggaagtcgcactacaatgaagaaggattgcagcgtcctactgtg 33138633  T
Q  101 agaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagtgttctccagaggagtggttata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33138634 agaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagtgttctccagaggagtggttata 33138733  T
Q  201 ggatcgaaggagatttgtttat 222  Q
    ||||| ||||||||||||||||    
T  33138734 ggatcaaaggagatttgtttat 33138755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 128
Target Start/End: Original strand, 18558754 - 18558792
Alignment:
Q  90 gtcctactgtgagaagtgatgggtggttggagattgaga 128  Q
    |||||| ||||||| ||||||||||||||||||||||||    
T  18558754 gtcctagtgtgagacgtgatgggtggttggagattgaga 18558792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 11 - 196
Target Start/End: Original strand, 17664498 - 17664677
Alignment:
Q  11 agaagcgttaaatccgtttgtttggatccagacttggaacattggcggaagtggcactgcaatgaagaaggattgcagcgtcctactgtgagaagtgatg 110  Q
    |||||| ||||||| ||||||||||||||| ||||||||||| ||| |      |||  ||| |||| ||||||||| ||||||| ||| ||| ||||||    
T  17664498 agaagcattaaatctgtttgtttggatccaaacttggaacataggcag------cacaacaacgaagcaggattgcaacgtcctagtgttagatgtgatg 17664591  T
Q  111 ggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagtgttctccagaggagtggt 196  Q
    | ||||||||||||||||||||| ||||||| ||||||||||  ||||||||||||||||  ||||||||| |||| |||||||||    
T  17664592 gatggttggagattgagatgggagaattctttaattcaagcctcaaagatgaagaagtccacatgagtgttatccaaaggagtggt 17664677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 19246908 - 19247080
Alignment:
Q  18 ttaaatccgtttgtttggatccagacttggaacattggcggaagtggcactgcaatgaagaaggattgcagcgtcctactgtgagaagtgatgggtggtt 117  Q
    ||||||| ||||||||||||||| ||||||||||| ||  |      |||  ||| |||| ||||||||| ||||||| ||| ||| ||||||| |||||    
T  19246908 ttaaatctgtttgtttggatccaaacttggaacataggacg------cacaacaacgaagcaggattgcaacgtcctagtgttagatgtgatggatggtt 19247001  T
Q  118 ggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagtgttctccagaggagtggt 196  Q
    |||||||||||||||| ||||||| ||||||||||  |||||||||||| |||  ||||||||| ||||||||||||||    
T  19247002 ggagattgagatgggagaattctttaattcaagcctcaaagatgaagaaatccacatgagtgttatccagaggagtggt 19247080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 79 - 181
Target Start/End: Original strand, 899746 - 899848
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagt 178  Q
    |||||||||||| |||||  ||||||| ||||||||||||||||||||||||||| | || ||||||||||| | | |||  ||||||||||  ||||||    
T  899746 aggattgcagcgccctaccatgagaagcgatgggtggttggagattgagatgggagagttattcaattcaagacttgaaggagaagaagtccaaatgagt 899845  T
Q  179 gtt 181  Q
    |||    
T  899846 gtt 899848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 74 - 138
Target Start/End: Complemental strand, 23331972 - 23331908
Alignment:
Q  74 gaagaaggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaatt 138  Q
    ||||||| |||||| ||||||| ||||||||| ||||||||||||||||||||||||||| ||||    
T  23331972 gaagaagaattgcatcgtcctaatgtgagaagcgatgggtggttggagattgagatgggagaatt 23331908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 19)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 79 - 166
Target Start/End: Complemental strand, 34309524 - 34309437
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaa 166  Q
    ||||||||| ||||||| ||| ||||||||||| ||||||||||||||||||||| | |||||||||||||||| | |||||||||||    
T  34309524 aggattgcaacgtcctaatgtaagaagtgatggatggttggagattgagatgggagagttcttcaattcaagccttgaagatgaagaa 34309437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 97 - 181
Target Start/End: Complemental strand, 35212123 - 35212039
Alignment:
Q  97 tgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagtgtt 181  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||||| |||| | ||||||||||| |||  |||||||||    
T  35212123 tgtgagaagtgatgggtggttggagattgagatgggagagttcttcaattctagccttgaagatgaagaaatccaaatgagtgtt 35212039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 79 - 148
Target Start/End: Complemental strand, 35190538 - 35190469
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattca 148  Q
    ||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||| | ||||||||||||    
T  35190538 aggattgcaacgtcctagtgtgagaagtgatgggtggttggagattgagatcggagagttcttcaattca 35190469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 80 - 148
Target Start/End: Complemental strand, 35270610 - 35270542
Alignment:
Q  80 ggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattca 148  Q
    |||||||| ||||||| ||||||||||||||||||||||||||||||||||||  | ||||||||||||    
T  35270610 ggattgcaacgtcctagtgtgagaagtgatgggtggttggagattgagatgggggagttcttcaattca 35270542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 79 - 181
Target Start/End: Original strand, 35295849 - 35295951
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagt 178  Q
    ||||||||| |  |||| ||||||||||||||||||||||||||||||||||||| | |||||||||||| ||     ||||||||||||||  ||||||    
T  35295849 aggattgcaacagcctagtgtgagaagtgatgggtggttggagattgagatgggagagttcttcaattcaggcttagtagatgaagaagtccaaatgagt 35295948  T
Q  179 gtt 181  Q
    |||    
T  35295949 gtt 35295951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 79 - 148
Target Start/End: Complemental strand, 35276709 - 35276640
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattca 148  Q
    ||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||  | ||||||||||||    
T  35276709 aggattgcaacgtcctagtgtgagaagagatgggtggttggagattgagatgggggagttcttcaattca 35276640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 86 - 146
Target Start/End: Complemental strand, 35205077 - 35205017
Alignment:
Q  86 cagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaatt 146  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||| | || |||||||    
T  35205077 cagcgtcctaatgtgagaagtgatgggtggttggagattgagatgggagattttttcaatt 35205017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 81 - 181
Target Start/End: Complemental strand, 35225086 - 35224986
Alignment:
Q  81 gattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagtgt 180  Q
    ||||||| ||||||| ||||||||| ||||| ||||| ||||||||||||||| | ||||||| |||| |||   |||||||||||||||  ||||||||    
T  35225086 gattgcaacgtcctaatgtgagaagcgatggctggttagagattgagatgggagagttcttcatttcaggcctagaagatgaagaagtccaaatgagtgt 35224987  T
Q  181 t 181  Q
    |    
T  35224986 t 35224986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 79 - 181
Target Start/End: Complemental strand, 45525639 - 45525540
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagt 178  Q
    |||||||| |||||||  ||||||||||||||||||||||||||||||||||||| |    ||||||||| ||| | || ||||||||||||  ||||||    
T  45525639 aggattgccgcgtcctggtgtgagaagtgatgggtggttggagattgagatgggaga---gttcaattcaggccttgaaaatgaagaagtccagatgagt 45525543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 79 - 181
Target Start/End: Complemental strand, 45531740 - 45531638
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagt 178  Q
    |||||||| ||| |||| |  |||||||| | |||||| |||||||||||||||| | |||||||||||| ||| | || |||||||||||| |||||||    
T  45531740 aggattgccgcggcctagttggagaagtggtaggtggtgggagattgagatgggagagttcttcaattcaggccttgaaaatgaagaagtccatatgagt 45531641  T
Q  179 gtt 181  Q
    |||    
T  45531640 gtt 45531638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 79 - 132
Target Start/End: Complemental strand, 35147530 - 35147477
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatggg 132  Q
    ||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||    
T  35147530 aggattgcaacgtcctagtgtgagaagcgatgggtggttggagattgagatggg 35147477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 79 - 132
Target Start/End: Complemental strand, 35263186 - 35263133
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatggg 132  Q
    ||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||    
T  35263186 aggattgcaacgtcctagtgtgagaagcgatgggtggttggagattgagatggg 35263133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 97 - 181
Target Start/End: Complemental strand, 35194650 - 35194566
Alignment:
Q  97 tgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgagtgtt 181  Q
    ||||||||| |||||||||||||||||||| |||||  | ||||||||| |||||| | ||||||||||||| |  |||||||||    
T  35194650 tgtgagaagcgatgggtggttggagattgaaatgggggagttcttcaatccaagccttgaagatgaagaagtgcaaatgagtgtt 35194566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 99 - 170
Target Start/End: Complemental strand, 8639056 - 8638985
Alignment:
Q  99 tgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtcc 170  Q
    |||||||||||||||||||||||| |||||||||| | |||||||||||| ||    |||||||||||||||    
T  8639056 tgagaagtgatgggtggttggagactgagatgggagagttcttcaattcaggcttagaagatgaagaagtcc 8638985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 89 - 146
Target Start/End: Complemental strand, 35476467 - 35476410
Alignment:
Q  89 cgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaatt 146  Q
    ||||||| ||||||| ||||||||||||||||||||||||||||| | ||||| ||||    
T  35476467 cgtcctagtgtgagacgtgatgggtggttggagattgagatgggagagttctttaatt 35476410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 79 - 152
Target Start/End: Complemental strand, 35189486 - 35189413
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagcc 152  Q
    |||||||||  |||||  ||||||||||||| |||||||||||||||  |||||  | ||||||||||||||||    
T  35189486 aggattgcaatgtccttgtgtgagaagtgataggtggttggagattggaatgggggagttcttcaattcaagcc 35189413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 79 - 148
Target Start/End: Complemental strand, 35200107 - 35200038
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattca 148  Q
    ||||||||| || |||| ||||||||| |||||||||||||||||||| || ||  | ||||||||||||    
T  35200107 aggattgcaacgccctagtgtgagaagcgatgggtggttggagattgaaatcggggagttcttcaattca 35200038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 79 - 146
Target Start/End: Complemental strand, 35248445 - 35248378
Alignment:
Q  79 aggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaatt 146  Q
    |||||||||  || ||| ||||||||| ||||||||||| ||||||||||||||  | ||||||||||    
T  35248445 aggattgcaaagttctattgtgagaagcgatgggtggtttgagattgagatgggggagttcttcaatt 35248378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 148
Target Start/End: Complemental strand, 35208289 - 35208239
Alignment:
Q  98 gtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattca 148  Q
    |||||||| ||||||||||||||||||||||| ||  | ||||||||||||    
T  35208289 gtgagaagcgatgggtggttggagattgagattggggagttcttcaattca 35208239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 78 - 181
Target Start/End: Complemental strand, 38632060 - 38631957
Alignment:
Q  78 aaggattgcagcgtcctactgtgagaagtgatgggtggttggagattgagatgggaaaattcttcaattcaagccctaaagatgaagaagtccgtatgag 177  Q
    |||||||||  ||| ||| ||| ||||  |||||||||||||||||| | |||||| | ||||||| ||||  || ||||||||||||| |||  |||||    
T  38632060 aaggattgcgacgtgctagtgtaagaaacgatgggtggttggagattcatatgggagagttcttcacttcagaccttaaagatgaagaaatccagatgag 38631961  T
Q  178 tgtt 181  Q
    ||||    
T  38631960 tgtt 38631957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University