View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16717_low_8 (Length: 350)
Name: NF16717_low_8
Description: NF16717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16717_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 25 - 336
Target Start/End: Original strand, 25777936 - 25778247
Alignment:
| Q |
25 |
gcgacttcgttcttgcaaaaaacagtttggttagcccctctttgtgatattgaggtgggagggatatttggtttacacaaagcgttagaataggttttag |
124 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25777936 |
gcgacttcgttcttgcaaaaaacagtctggttagcccctctttgtgatatcgaggtgggagggatatttggtttacacaaagcgttagaataggttttag |
25778035 |
T |
|
| Q |
125 |
accatcagtttgacaacgtagattttgctctagactgtaagatcatttatcaatttagaacattgtgtatttcgttgtattatatctaccggtaaacaat |
224 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25778036 |
accatcagttcgacaatgtagattttgctctagactgtaagatcatttatcaatttagaacgttgtgtatttcgttgtattatatctaccgataaacaat |
25778135 |
T |
|
| Q |
225 |
tgttacatgatagttttcagaactttaaagttgagatcaataggaggaaaactaatgaggttcctcacgaattaacacataaccccatataatgctaaca |
324 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25778136 |
tgttacatgatagttttcataactttaaagttgagatcaataggaggaaaactaatgaggttcctcacgaattaacacataaccccatataatgctaaca |
25778235 |
T |
|
| Q |
325 |
cacatatttaga |
336 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25778236 |
cacatatttaga |
25778247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University