View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16718_high_4 (Length: 395)
Name: NF16718_high_4
Description: NF16718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16718_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 1 - 375
Target Start/End: Original strand, 913773 - 914147
Alignment:
| Q |
1 |
atatgcctagaaaaaatgtgatatcttggtccagtatgatcaatgcatttgcaatgcatgggaatgcagatagtgctataaaaattttccataggatgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
913773 |
atatgcctagaaaaaatgtgatatcttggtccagtatgatcaatgcatttgcaatgcatgggaatgcagatagtgctataaaacttttccgtaggatgaa |
913872 |
T |
|
| Q |
101 |
agaagtaaatattgaacccaatggtgttacatttataggcgtcctttatgcttgcggtcatgcgggtttagttgaggaaggtgagaaattattttcatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
913873 |
agaagtaaatattgaacccaatggtgttacatttataggcgtcctttatgcttgcggtcatgcgggtttagttgaggaaggtgagaaattattttcatcc |
913972 |
T |
|
| Q |
201 |
atgattaatgagcatggaatctctccgacccgtgagcactatggttgcatggttgacctgtattgtcgagccaatttcttgagaaaagctattgagctta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
913973 |
atgattaatgagcatggaatctctccgacccgtgagcactatggttgcatggttgacctgtattgtcgagccaatttcttgagaaaagctattgagctta |
914072 |
T |
|
| Q |
301 |
ttgagacaatgccttttgcgccaaatgttatcatttggggatcccttatgtctgcttgtcaagttcacggggagg |
375 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
914073 |
tcgagacaatgccttttgcgccaaatgttatcatttggggatcccttatgtctgcttgtcaagttcacggggagg |
914147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University