View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16719_high_20 (Length: 256)
Name: NF16719_high_20
Description: NF16719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16719_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 25 - 227
Target Start/End: Complemental strand, 2107404 - 2107202
Alignment:
| Q |
25 |
taatttctgcaaatgtgtgcaaagaacactcgattcacacaaaaatccagagaatcataaaaactaaaaggaagacttgttaattcgttttaagaaggaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2107404 |
taatttctgcaaatgtgtgcaaagaacactcgattcacacaaaaatccagagaagcataaaaactaaaaggaagacttgttaatacgttttaagaaggaa |
2107305 |
T |
 |
| Q |
125 |
agagctaaaatagttaactctttactgggtttggtatctttatacggatccttgtccaacataattgtataatgcttgtatatttctccacttgtatatc |
224 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2107304 |
agagctaaaatggttaactctttactgggtttggtatctttatacggatccatgtccaacataattgtataatgcttgtatatttctccacttgtatatc |
2107205 |
T |
 |
| Q |
225 |
acc |
227 |
Q |
| |
|
||| |
|
|
| T |
2107204 |
acc |
2107202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University