View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16719_low_12 (Length: 348)
Name: NF16719_low_12
Description: NF16719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16719_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 49755702 - 49755364
Alignment:
| Q |
1 |
ctcttgcttttcaatccaacggccaatggaactcttcgttttctttcatctctaccgtgttcctctaacagaactcgcctagtcggaagagttaactcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
49755702 |
ctcttgcttttcaatccaacggccaatggaactcttcgttttctttcatctctaccgtgttcctctaaaagaactcgcctagtcggaagagttaactccg |
49755603 |
T |
 |
| Q |
101 |
ttccaacgaacgacgaagagtcatgatgttgtggaagagtggaccgagaagggagatagtggaagaagaaagtggaaattgctattccaatgagaaggaa |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755602 |
ttccaacgaacgaagaagagtcatgatgttgtggaagagtggatcgagaagggagatagtggaagaagaaagtggaaattgctattccaatgagaaggaa |
49755503 |
T |
 |
| Q |
201 |
agggactcgatttagaagca---------tgtttgttctcgttcttggaagaggattatcacgatgggatgatgaatctgtggtttgatctcttgtttgg |
291 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755502 |
agggactcgatttagaagcatgttgatgatgtttgttctcgttcttggaagaggattatcacgatgggatgatgaatctgtggtttgatctcttgtttgg |
49755403 |
T |
 |
| Q |
292 |
tttctgtgaattagttcagagctcattttgtttttgtat |
330 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49755402 |
tttctgtgaattagttcagaactcattttgtttttgtat |
49755364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University