View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16719_low_25 (Length: 214)
Name: NF16719_low_25
Description: NF16719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16719_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 8e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 91 - 206
Target Start/End: Original strand, 55127807 - 55127922
Alignment:
| Q |
91 |
catgcatcatgacctacatacataaactaaaatttccaattttcataatcaaaatcataatcaatgcatgagggatgagggaaagggaaacccacctcta |
190 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55127807 |
catgcattatgacctacatacataaactaaaatttccaattttcataatcaaaatcataatcaatgcatgagggatgagggaaagggaaacccacctcta |
55127906 |
T |
|
| Q |
191 |
agtttctctgatgatg |
206 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
55127907 |
agtttctctgatgatg |
55127922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 55127671 - 55127753
Alignment:
| Q |
1 |
attacttaaaaaggatgtataaattgaaagttatgaacaaaacagtagcatgatgtccaaatacgggattgcagatttatacc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55127671 |
attacttaaaaaggatgtataaattgaaagttatgaacaaaacagtagcatgatgtcaaaatacgggattgcagatttatacc |
55127753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 12082623 - 12082570
Alignment:
| Q |
154 |
atgcatgagggatgagggaaa-gggaaacccacctctaagtttctctgatgatg |
206 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| |||||||||||| |||||||| |
|
|
| T |
12082623 |
atgcatgagggatgagggaaaggggaaatccatctctaagtttctatgatgatg |
12082570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 33570838 - 33570786
Alignment:
| Q |
155 |
tgcatgagggatgagggaaagggaaacccacctctaagtttctctgatgatgt |
207 |
Q |
| |
|
|||| |||||||||||| ||| ||||||||||| ||||| ||| ||||||||| |
|
|
| T |
33570838 |
tgcacgagggatgaggggaagagaaacccacctttaagtctctatgatgatgt |
33570786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University