View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16720_high_22 (Length: 261)
Name: NF16720_high_22
Description: NF16720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16720_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 244
Target Start/End: Complemental strand, 3487352 - 3487106
Alignment:
| Q |
7 |
ataccaatatcgaacgcatatacagcgcgaacacttcttggttgcatgagaagcacaaacag---------gctcatcggagttaagaacaccgtgcatt |
97 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
3487352 |
ataccaatatcgaacgcctttacagcgcgaacacttcttggtggcatgagaagcacaaacagcacaaacaggctcatcggagttaagaacaccgggcatt |
3487253 |
T |
 |
| Q |
98 |
gtggaggtgggagaagaaggatgatgatctccttcgaaattagcgtcgacttcgaagtatttagaagcggtgtttttgacaagagtgtgtaatccaatag |
197 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3487252 |
ggggaggtgggagaagaaggatgatgatctccttcgaaattagcgtcgacttcgaagtatttagaagcggtgtttttgacaagagtgtgtaatccaatag |
3487153 |
T |
 |
| Q |
198 |
cgattacaagagcggtgaatatgaattgaaggaatcgattgagatcc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3487152 |
cgattacaagagcggtgaatatgaattgaaggaatcgattgagatcc |
3487106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University