View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16720_high_30 (Length: 217)
Name: NF16720_high_30
Description: NF16720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16720_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 21 - 202
Target Start/End: Original strand, 7565860 - 7566042
Alignment:
| Q |
21 |
gatatccagaagatgagaaagacagtgttttccagccatgaatctaacaccagcagcttcaccagtagtggcgagatgggccaaactccaccaaagctga |
120 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7565860 |
gatatgcagaagatgagaaagacagtgttttccagccatgaatctaacaccagcagcttcaccagtagtggcgagatgggccaaactccaccaaagctga |
7565959 |
T |
|
| Q |
121 |
agactccacaacaattgccttaagctgttaatcatacatgtggaaaggattagagggacaaaaattc-aaggggttgcttttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7565960 |
agactccacaacaattgccttaagctgttaatcatacatgtggaaaggattagagggacaaaaattcaaaggggttgcttttg |
7566042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University