View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16720_high_31 (Length: 214)
Name: NF16720_high_31
Description: NF16720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16720_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 40754909 - 40754728
Alignment:
| Q |
18 |
ttctttacttctttcatgccaaacaaattaaattgttgataagaacaaaagaaaattgcataaaactgatcatgacaattccctcatgttagttagttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40754909 |
ttctttacttctttcatgccaaacaaattaaattgttgataagaacaatagaaaattgcataaaactgatcatgacaattccctcatgttagttagttaa |
40754810 |
T |
 |
| Q |
118 |
tccgatttgctttatctttttgttagaatcaattaaagtatccgtttaaacagttaatttgttagtctctagtaatagtatt |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40754809 |
tccgatatgctttatctttttgttagaatcaattaaagtatccgtttaaacagttaatttgttagtctctagtaatagtatt |
40754728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University