View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16720_low_14 (Length: 388)
Name: NF16720_low_14
Description: NF16720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16720_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 216 - 259
Target Start/End: Complemental strand, 20696271 - 20696228
Alignment:
| Q |
216 |
taacttgaataagaattacacacccctagtcgcctaaaaattca |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
20696271 |
taacttgaataagaattacacacccctagtcctctaataattca |
20696228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University