View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16720_low_19 (Length: 324)
Name: NF16720_low_19
Description: NF16720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16720_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 317
Target Start/End: Original strand, 17623064 - 17623097
Alignment:
| Q |
284 |
aaccaaaaacctcgacattccaccttttcatctc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
17623064 |
aaccaaaaacctcgacattccaccttttcatctc |
17623097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University