View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16720_low_30 (Length: 234)
Name: NF16720_low_30
Description: NF16720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16720_low_30 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 23312208 - 23311996
Alignment:
| Q |
14 |
gtttatgcagtgttatcaaccgcggattgtgaaaaatagcaatttgttcaaattatgctacactatagcactatagagccgccgctatttgacagcaatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
23312208 |
gtttatgcagtgttatcaaccgcggattgtgaaaaatagcaatttgttcaaattgtgctacactatag--------agccgccgctatttgacagcaacg |
23312117 |
T |
 |
| Q |
114 |
tgtttatgttctttaggatgttctatcattaatggatgtaagttaatgcttgtgcttccttttctgtcttttgcttaactaacatatatcgttttgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23312116 |
tgtttatgttctttaggatgttctatcattaatggatgtaagttaatgcttgtgcttccttttctgtcttttgcttaactaacatatatcgttttgcagg |
23312017 |
T |
 |
| Q |
214 |
ccctcaaatatgtcagtttcc |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23312016 |
ccctcaaatatgtcagtttcc |
23311996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 82
Target Start/End: Original strand, 48025656 - 48025690
Alignment:
| Q |
48 |
aatagcaatttgttcaaattatgctacactatagc |
82 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48025656 |
aatagcagtttgttcaaattatgctacactatagc |
48025690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 122382 - 122345
Alignment:
| Q |
48 |
aatagcaatttgttcaaattatgctacactatagcact |
85 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
122382 |
aatagcgatttgttcaaattacgctacactatagcact |
122345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 78
Target Start/End: Original strand, 10275753 - 10275802
Alignment:
| Q |
29 |
tcaaccgcggattgtgaaaaatagcaatttgttcaaattatgctacacta |
78 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
10275753 |
tcaatcgcggattgcagaaaatagcaatttgttcaaattacgctacacta |
10275802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University