View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16722_high_21 (Length: 254)
Name: NF16722_high_21
Description: NF16722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16722_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 11 - 239
Target Start/End: Complemental strand, 22574780 - 22574552
Alignment:
| Q |
11 |
atgaatgtaatgttttagtgtttaaaaaatatgtacttaaacatgcttcataagtcaggttttataggaaaaagataaaggannnnnnnnggatgaaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
22574780 |
atgaatgtaatgttttagtgtttaaaaaatgtgtacttaaacatgtttcataagtcaggttttataggaaaaagataaaggattttttttggataaaaac |
22574681 |
T |
 |
| Q |
111 |
cctaattgaacaactttagacatatcattgtgtgatattcatcatattgtcctacaaggattcccaaatctggtttttgtgtatctttaagcctgtccaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
22574680 |
cctaattgaacaactttagacatatcattgtgtgatattcatcatattgtcctacaaggattccgaaatctggtttttgcgtatctttaagcctgtccaa |
22574581 |
T |
 |
| Q |
211 |
aacatagtctaagatgagttaacattgtt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22574580 |
aacatagtctaagatgagttaacattgtt |
22574552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University