View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16722_high_23 (Length: 222)
Name: NF16722_high_23
Description: NF16722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16722_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 49451078 - 49450891
Alignment:
| Q |
17 |
cataggtacgtctcttaattcacaatttatttcatgttaattgttgcatgcactgctttctagttactannnnnnnnnnnnn-attgtgggagttgagag |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49451078 |
cataggtacgtttcttaattcacaatttatttcatgttaattattgcatgcactgctttctagttactatttttaaattttttattgtgggagttgagag |
49450979 |
T |
|
| Q |
116 |
tcgtcgcctactcctaaattcccactgatgtagattttcaaatctgggcatatgtatggtgatctatgaaccacttccatgtgctaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49450978 |
tcgtcgcctactcctaaattcccactgatgtagattttcaaatctgggcatatgtatggtgatctatgaaccacttccatgtgctaat |
49450891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University