View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16722_high_27 (Length: 204)
Name: NF16722_high_27
Description: NF16722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16722_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 112 - 188
Target Start/End: Complemental strand, 23956672 - 23956596
Alignment:
| Q |
112 |
gttaaatttattttgtgcagttctgggacatctggaggtgagagaaagttgatgccaacaattgaagaagagttagg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23956672 |
gttaaatttattttgtgcagttctgggacatctggaggtgagagaaagttgatgccaacaattgaagaagagttagg |
23956596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University