View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16722_low_18 (Length: 294)
Name: NF16722_low_18
Description: NF16722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16722_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 275
Target Start/End: Complemental strand, 3676767 - 3676507
Alignment:
| Q |
16 |
acccagaacatctcagatttaaaatctgnnnnnnngcaactagtttggatttagataggcatatcatcaaactagtnnnnnnnn-cacaactaatagtgt |
114 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
3676767 |
acccagaacatctcaaatttaaaatctgtctttttgcaactagtttggatttagataggcatatcatcaaactagtaaaaaaaaacacaactaataatgt |
3676668 |
T |
 |
| Q |
115 |
catcaaatttgtacaaccattttttactcaaaatgaataatttgtacaatcattttatccctttaaaacaaagaaactaaagactaaagaggagtaatga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3676667 |
catcaaatttgtacaaccattttttactcaaaatgaataatttgtacagtcattttatccctttaaaacaaagaaactaaagactaaagaggagtaatga |
3676568 |
T |
 |
| Q |
215 |
attttagaattcaatcaaaatatcttccttcaaccaaataattgcaaatggctagtttgtc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3676567 |
attttagaattcaatcaaaatatcttccttcaaccaaataattgcaaatagctagtttgtc |
3676507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University