View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16722_low_23 (Length: 238)
Name: NF16722_low_23
Description: NF16722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16722_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 94 - 221
Target Start/End: Complemental strand, 25301274 - 25301147
Alignment:
| Q |
94 |
ttggaatgttaagatgcaaatattttaacattgtaaatgcactaaatctatcccaactgcttgtatattttggattcaactttcaagtgatcataatagt |
193 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25301274 |
ttggaatgttaagatgcaaattttttaacattgtaaatgcactaaatttataccaactgcttgtatattttggattcaactttcaagtgatcataatagt |
25301175 |
T |
 |
| Q |
194 |
gagaggatattgttttggtataatttat |
221 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
25301174 |
gagaggatatttttttggtataatttat |
25301147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University