View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16723_low_6 (Length: 203)
Name: NF16723_low_6
Description: NF16723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16723_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 44706630 - 44706816
Alignment:
| Q |
17 |
gaaccatgcatgtgttgtatggccatctccacttgaaatgtcgggtgaaaaaataaatgccaagttatgccaaaattgaattcccattagttaaggatct |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44706630 |
gaaccatgcatgggttgtatggccatctccacttgaaatgtcgggtgaaaaaataaatgccaagttatgccaaaattgaattcccattagttaaggatct |
44706729 |
T |
|
| Q |
117 |
tctaaacaaaacaacaaaaaaggtttgtctagagaatacttagctccttctaaaaaatagaataggaaggagaatgcttagctacat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
44706730 |
tctaaacaaaacaacaaaaaaggtttgtctagagaatacttagctccttttaaaaaatagaaaaagaaggagaatgcttagctacat |
44706816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University