View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16724_low_17 (Length: 206)
Name: NF16724_low_17
Description: NF16724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16724_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 4152527 - 4152695
Alignment:
| Q |
18 |
agatataccttccttgcacaacctatgaatcaccatatatagtaccatatcccaaataaactcattcttttttcttcttccattttctatatcacaaaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4152527 |
agatataccttccttgcacaacctacgaat--------atagtaccatatcccaaataaactcattcttttttcttcttccattttctatatcacaaaaa |
4152618 |
T |
 |
| Q |
118 |
tgaaaatgccttcttttctaggttctttacctccacgatcattcttcttttgtttcctccttcttccacctttgctt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4152619 |
tgaaaatgccttcttttctaggttctttacctccacgatcattcttcttttgtttcctccttcttccacttttgctt |
4152695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 78 - 185
Target Start/End: Original strand, 4159788 - 4159892
Alignment:
| Q |
78 |
ctcattcttttttcttcttccattttctatatcacaaaaatgaaaatgccttcttttctaggttctttacctccacgatcattcttcttttgtttcctcc |
177 |
Q |
| |
|
||||||||||||| |||||||||| | ||| |||||||||||||||||||||| || |||||||| | | |||||| |||||||||||||||||| ||| |
|
|
| T |
4159788 |
ctcattctttttt--tcttccatttcc-atagcacaaaaatgaaaatgccttctcttttaggttctattcatccacgctcattcttcttttgtttcatcc |
4159884 |
T |
 |
| Q |
178 |
ttcttcca |
185 |
Q |
| |
|
|||||||| |
|
|
| T |
4159885 |
ttcttcca |
4159892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University