View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16725_high_4 (Length: 302)
Name: NF16725_high_4
Description: NF16725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16725_high_4 |
 | |
|
| [»] scaffold0276 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0276 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 254
Target Start/End: Complemental strand, 19975 - 19736
Alignment:
| Q |
15 |
aattagatcatagattaatcagatgcataatgcattacactatgtgtttggtgtatcaatactgttagatatatatttctagtcgatgaatgtggatgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19975 |
aattagatcatagattaatcagatgcataatgcattacactatgtgtttggtgtatcaatactgttagatatatatttctagtcgatgaatgtggatgat |
19876 |
T |
|
| Q |
115 |
cacttagatatgatcttgattttagttatttatttatgtatgtccgatctctatttcatgtagtccagatcatgatcacaatgaataagcagtgctcaaa |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19875 |
cacttagatttgatcttgattttagttatttatttatgtatgtccgatctctatttcatgtagtccagatcatgatcacaatgaataagcagtgctcaaa |
19776 |
T |
|
| Q |
215 |
taggatcatactttttcctttgtttttctcatggcatgag |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19775 |
taggatcatactttttcctttgtttttctcatggcatgag |
19736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University