View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16726_low_5 (Length: 278)
Name: NF16726_low_5
Description: NF16726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16726_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 54277416 - 54277677
Alignment:
| Q |
1 |
gagatgaaaaaggtacatagattcaatctaaaacatattgtttcatactaaagttataagtaacataactttcattggnnnnnnncaccaggaagtaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54277416 |
gagatgaaaaaggtacatagattcaatctaaaacatattgtttcatactaaagttataagtaacataactttcattggtttgtttcaccaggaagtaagt |
54277515 |
T |
 |
| Q |
101 |
gaggttgtgactattaatggatatcatgacgtgccacaaaataatgaacaaagcttattgaaggcacttgccaatcaaccactcagtgtggccatagagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54277516 |
gaggttgtgactattaatggatatcatgacgtgccacaaaataatgaacaaagcttattgaaggcacttgccaatcaaccactcagtgtggccatagagg |
54277615 |
T |
 |
| Q |
201 |
cttcaggcagagatttccagttctatagtggagtatgtttaattaattaattataaaactat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54277616 |
cttcaggcagagatttccagttctatagtggagtatgtttaattaattaattataaaactat |
54277677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University