View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16727_high_16 (Length: 350)
Name: NF16727_high_16
Description: NF16727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16727_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 9e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 278 - 333
Target Start/End: Complemental strand, 25730721 - 25730666
Alignment:
| Q |
278 |
cactcgatcaaacgtttcttgcgtcacaaactaagattggtggatacataactatc |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25730721 |
cactcgatcaaacgtttcttgcgtcacaaactaagatttgtggatacataactatc |
25730666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 25730842 - 25730794
Alignment:
| Q |
157 |
ctattctcacaagataaaattgttgaacgaatggtgtaggtaagtcacc |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25730842 |
ctatactcacaagataaaattgttgaacgaatggtgtaggtaagtcacc |
25730794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University