View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16727_high_37 (Length: 238)
Name: NF16727_high_37
Description: NF16727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16727_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 16 - 165
Target Start/End: Original strand, 34209124 - 34209274
Alignment:
| Q |
16 |
atgaaaacattacatggc-aaaaaacacattacgaggaacttaactgggaatttggtaaaaccaatgaaaaatatggctcctgaatcctttcttctgagg |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34209124 |
atgaaaacattacatggggaaaaaacacattacgaggaacttaactgggaatttggtgaaaccaatgaaaaatatggctcctgaatcctttcttctgagg |
34209223 |
T |
|
| Q |
115 |
aattacgttcacgaggtttctctatacatggatgaagctcatattgtgggg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34209224 |
aattacgttcacgaggtttctctatacatcgatgaagctcatattgtgggg |
34209274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 162 - 220
Target Start/End: Original strand, 34209429 - 34209487
Alignment:
| Q |
162 |
ggggccatgtgactaggttggtggtggtcgtaaatgtgtgtttcgatcgagggtttatg |
220 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||| || |||||||| |
|
|
| T |
34209429 |
ggggccatgtgactaggtcggtcgtggtcgtaaatgtgtgtttcgattgatggtttatg |
34209487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University