View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16727_high_37 (Length: 238)

Name: NF16727_high_37
Description: NF16727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16727_high_37
NF16727_high_37
[»] chr2 (2 HSPs)
chr2 (16-165)||(34209124-34209274)
chr2 (162-220)||(34209429-34209487)


Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 16 - 165
Target Start/End: Original strand, 34209124 - 34209274
Alignment:
16 atgaaaacattacatggc-aaaaaacacattacgaggaacttaactgggaatttggtaaaaccaatgaaaaatatggctcctgaatcctttcttctgagg 114  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
34209124 atgaaaacattacatggggaaaaaacacattacgaggaacttaactgggaatttggtgaaaccaatgaaaaatatggctcctgaatcctttcttctgagg 34209223  T
115 aattacgttcacgaggtttctctatacatggatgaagctcatattgtgggg 165  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||    
34209224 aattacgttcacgaggtttctctatacatcgatgaagctcatattgtgggg 34209274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 162 - 220
Target Start/End: Original strand, 34209429 - 34209487
Alignment:
162 ggggccatgtgactaggttggtggtggtcgtaaatgtgtgtttcgatcgagggtttatg 220  Q
    |||||||||||||||||| ||| |||||||||||||||||||||||| || ||||||||    
34209429 ggggccatgtgactaggtcggtcgtggtcgtaaatgtgtgtttcgattgatggtttatg 34209487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University