View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16727_high_47 (Length: 206)
Name: NF16727_high_47
Description: NF16727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16727_high_47 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 41917462 - 41917259
Alignment:
| Q |
1 |
tactttatattcactcctttgcttgcccatctttggcattctagttgcaccaactcctacannnnnnnnnngtcaccataaaattaatgttaatcaatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41917462 |
tactttatattcactcctttgcttgcccatctttggcattctagttgcaccaactcctacatttttttt--gtcaccataaaattaatgttaatcaatat |
41917365 |
T |
 |
| Q |
101 |
cacatgatcgatgnnnnnnnaaaactagacttttttcttgttagggtaaaactaataaaacattgattttgctccgaagggtttgaaaggtacgtgacta |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41917364 |
cacatgatcgatgtttttttaaaactagacttttttcttgttagggtaaaactaataaaacattgattttgttccgaagggtttgaaaggtacgtgacta |
41917265 |
T |
 |
| Q |
201 |
cgatct |
206 |
Q |
| |
|
|||||| |
|
|
| T |
41917264 |
cgatct |
41917259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 26832768 - 26832825
Alignment:
| Q |
1 |
tactttatattcactcctttgcttgcccatctttggcattctagttgcaccaactcct |
58 |
Q |
| |
|
|||||||||||||| ||||||||| |||||| ||||||||| ||| |||||||||| |
|
|
| T |
26832768 |
tactttatattcacacctttgcttctccatctacggcattctacttgtaccaactcct |
26832825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University