View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16727_low_29 (Length: 293)
Name: NF16727_low_29
Description: NF16727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16727_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 11064960 - 11064821
Alignment:
| Q |
1 |
ttacctgcaccttcaattcgaggagaaacattgttaattaagatcacgaatgctgcttactttcgagggttggaagcttgtaaaactaaccttcggggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11064960 |
ttacctgcaccttcaattcgaggagaaacattgttaattaagatcacgaatgctgcttactttcgagggttggaagcttgtaaaactaaccttcggggta |
11064861 |
T |
|
| Q |
101 |
ggctgattttgtacaaaggtgacaaaccatatttgcaaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11064860 |
ggctgattttgtacaaaggtgacaaaccatatttgcaaaa |
11064821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 132 - 267
Target Start/End: Complemental strand, 11064629 - 11064494
Alignment:
| Q |
132 |
tttgcaaaacttcaaaaagtgtggaaagttactggtccatggagtctgctttcattaggaagaagattttaccagttctcatttgcctcccatgaggatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11064629 |
tttgcaaaacttcaaaaagtgtggaaagtcactggtccatggagtttgctttcattaggaagaagattttacgagttctcatttgcctcccatgaggatt |
11064530 |
T |
|
| Q |
232 |
tgcgcacagtttgggtagcgggcaccgtcaatttga |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11064529 |
tgcgcacagtttgggtagcgggcaccgtcaatttga |
11064494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 131
Target Start/End: Original strand, 20490891 - 20491007
Alignment:
| Q |
15 |
aattcgaggagaaacattgttaattaagatcacgaatgctgcttactttcgagggttggaagcttgtaaaactaaccttcggggtaggctgattttgtac |
114 |
Q |
| |
|
|||||| || |||||||||| ||||||||| || || | |||||||||||||||||||||||||||| ||||||| ||||| |||| ||||| || || |
|
|
| T |
20490891 |
aattcgtggggaaacattgtcaattaagataacaaaggatgcttactttcgagggttggaagcttgtcgaactaacattcggagtagcctgatgttaaac |
20490990 |
T |
|
| Q |
115 |
aaaggtgacaaaccata |
131 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
20490991 |
aaaggcgacaaaccata |
20491007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University