View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16727_low_32 (Length: 270)
Name: NF16727_low_32
Description: NF16727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16727_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 19 - 118
Target Start/End: Complemental strand, 28243965 - 28243866
Alignment:
| Q |
19 |
atcccacccgatctagccatctttgctacagatacattttaactgatactaaatcaaatcatgcacttcactctctctaaacaaagatcaccctgataac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28243965 |
atcccacccgatctagccatctttgctacagatacattttaactgataccaaatcaaatcattcacttcactctctctaaacaaagatcaccctggtaac |
28243866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 215 - 270
Target Start/End: Complemental strand, 28243769 - 28243714
Alignment:
| Q |
215 |
gataaataggtaagatcaagtaaaatggagtaaatgatgaagaaatagttgaaatt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28243769 |
gataaataggtaagatcaagtaaaatggagtaaatgatgaagaaatagttgaaatt |
28243714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University