View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16727_low_8 (Length: 524)
Name: NF16727_low_8
Description: NF16727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16727_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 12 - 145
Target Start/End: Complemental strand, 37806086 - 37805953
Alignment:
| Q |
12 |
attattcttcttttaaatatatttgtgtgtgtatttaaataaatttgatttgaggttgtgctggagtaaaaattgatccatggacatgattagtgtttgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37806086 |
attattcttcttttaaatatatttgtgtgtgtatttaaataaatttgatttgagattgtgctagagtaaaaattgctccatggacttgattagtgtttgt |
37805987 |
T |
|
| Q |
112 |
ggtatactatttacttgtatataaaatgaggcgt |
145 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |
|
|
| T |
37805986 |
ggcatactatttacttgtatataaaatgaggcgt |
37805953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 388 - 476
Target Start/End: Complemental strand, 37805688 - 37805600
Alignment:
| Q |
388 |
atgttatcaagaagaaaataaaatgtatttttcatcgacatgcaagtgatgtgatatgtctactaatatctttgcttaacgatcacaag |
476 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
37805688 |
atgttatcaagaagaaaataaaatgtatttttcatcgacatgcaagtgatgtgatatgtctactaatttctttgcttaacaatcacaag |
37805600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 251 - 321
Target Start/End: Complemental strand, 37805848 - 37805778
Alignment:
| Q |
251 |
ctcactttaacatcatatttttatcggatgaaatcttatatagattgcaccactctatctagacctcgttt |
321 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37805848 |
ctcactttaacattatatttttattggatgaaatcttatatagattgcaccactctatctagacctcgttt |
37805778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University