View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16728_high_8 (Length: 235)
Name: NF16728_high_8
Description: NF16728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16728_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 4928738 - 4928870
Alignment:
| Q |
1 |
aaaaaagatagaagctagctaaagatgtgtccgttcaaacaaaagcatagatagtaaactcggctctagaattgttaaaacaagagaagaaaatagatgt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4928738 |
aaaaaagataaaagctagctaaagatgtgtccgttcaaacaaaagcatagatagtaaactcggctctagaattgttaaaacaagagaagaaaatagatgt |
4928837 |
T |
|
| Q |
101 |
ttacaatcacaaataatggcaccaagctcagaa |
133 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
4928838 |
ttacaatcagaaataatggcaccaagctcagaa |
4928870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 125 - 220
Target Start/End: Original strand, 4929593 - 4929688
Alignment:
| Q |
125 |
agctcagaaacatcccttgtagaagaattgaaatgatcaactaatagcttcaaattttattcaaaatccacattatccaatttgagctcttgaatt |
220 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4929593 |
agctcagaaacatcccttgcagaagaattgaaatgatcaactaatagcttcaaattttattcaaaatccacattatccaatttgagctcttgaatt |
4929688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University