View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16728_low_8 (Length: 238)
Name: NF16728_low_8
Description: NF16728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16728_low_8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 55 - 238
Target Start/End: Original strand, 39985093 - 39985273
Alignment:
| Q |
55 |
tacgttgcccaacagatatgtcacaggtggtgatgattgaaaccaataatcatgcaaacgctgatgaatttcctctacctgcatgcatatttgtaattaa |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39985093 |
tacgttgcccaacagatatgtcacaggtggtgatgattgaaaccaataatcatgcaaacgctgatgaatttcctctacc---atgcatatttgtaattaa |
39985189 |
T |
|
| Q |
155 |
taacgctttttcaaaaaattatatgtatatccaaaaatgattgtatgttatgattatgatattatgcagtactttccctaaagt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39985190 |
caacgctttttcaaaaaattatatgtatatccaaaaatgattgtatgttatgattatgatattatgcagtactttccctaaagt |
39985273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University