View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16729_low_14 (Length: 219)
Name: NF16729_low_14
Description: NF16729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16729_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 25 - 202
Target Start/End: Original strand, 6414630 - 6414807
Alignment:
| Q |
25 |
gccatgatttttgtaattaatacacatagatatgcttgtttttgacattagttgtagatctgttttctttttagtgtttgcttttgagacacttcgttta |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6414630 |
gccatgatttttgtaattaatacacatagatatgcttgtttttgacattagttgtagatctgttttctttttactgtttgcttttgagacacttcgttta |
6414729 |
T |
|
| Q |
125 |
gagcttgcattgcgataattaagtaaattgtttaaggtgctgtttgggagtttggggagtttgcaaggaggggataag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6414730 |
gagcttgcattgcgataattaagtaaattgtttaagtttctgtttgggagtttggggagtttgcaaggaggggataag |
6414807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 103 - 157
Target Start/End: Original strand, 6403691 - 6403745
Alignment:
| Q |
103 |
tgcttttgagacacttcgtttagagcttgcattgcgataattaagtaaattgttt |
157 |
Q |
| |
|
|||||| || |||||| ||||||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
6403691 |
tgctttggaaacactttgtttagagcctgcattgcaataattaagtagattgttt |
6403745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University