View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16729_low_5 (Length: 432)
Name: NF16729_low_5
Description: NF16729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16729_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 178 - 418
Target Start/End: Complemental strand, 34971824 - 34971582
Alignment:
| Q |
178 |
cacttgggcaagtcgagtatcagt--aagatgcaaaaagtggataatttgacatgttgtctatgtctgaagaaaattactctttagacctcgaaaattgc |
275 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
34971824 |
cacttgggcaagtcgagtatcagtgtaagatgcaaaaagtggataatttgacatgttgtctatgtccgaagaaaattgctctttagacctcgaaaattgc |
34971725 |
T |
|
| Q |
276 |
tctcaatcagtccaaaaatgagtaatttatccctaactgcagttaactatcgtttgctcttcagcgatagttaaatgtcgtatgtaataattgcattctc |
375 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34971724 |
tctcaatcagtccaaaaatgagcaatttatccctaactgcagttaactatcgtttgctcttcaacgatagttaaatgtcgtatgtaataattgcattctc |
34971625 |
T |
|
| Q |
376 |
tagcatttaaatgcacaaccaagacacaacgacttgtcaaaac |
418 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34971624 |
tagcatttaaatgcacaaccaagatacaacgacttgtcaaaac |
34971582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 34971988 - 34971923
Alignment:
| Q |
10 |
agcagagaaaatgttgcagcttggaagagatcaaagaactgaattaaagtgagcttcaaaagctca |
75 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34971988 |
agcagaaaaaatgttgcagcttggaagagatcaaagacctgaattaaagtgagcttcaaaagctca |
34971923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University