View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16730_low_16 (Length: 265)
Name: NF16730_low_16
Description: NF16730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16730_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 243
Target Start/End: Original strand, 27439371 - 27439604
Alignment:
| Q |
10 |
tcatcagtacttactttgccgcgaattttggatttgagttgaggaatagtaaaatgaaggttagtttcagagagacaattagagagagaagaagtgatgg |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27439371 |
tcataagtacttactttgccgcgaattttggatttgagttgaggaagagcgaaatgaaggtttgtttcagagagacaattagagagagaagaagtgatgg |
27439470 |
T |
|
| Q |
110 |
ggtcaagaagttgttgtttgcgagtgttgttgatgagagtatctccaaaagaaggttgaatttcaccttgtttaggcgtcgttgaagcgcgaatcatggt |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
27439471 |
ggtccagaagttgttgtttgcgagtgttgttgatgagagtatctccaaaagaaggttgaatttcaccttgttttggcgtcgttgaagcgcaaatcatggt |
27439570 |
T |
|
| Q |
210 |
tgggattttgaatttgtttggtttgaaagcgatt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27439571 |
tgggattttgaatttgtttggtttgaaagcgatt |
27439604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University