View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16730_low_20 (Length: 208)
Name: NF16730_low_20
Description: NF16730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16730_low_20 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 10 - 208
Target Start/End: Complemental strand, 418679 - 418481
Alignment:
| Q |
10 |
aagaatatcgcgtttttgtaatataggccaactcccacatactttgctcccctgctttttatcggtttccactttgttttgctcaaaacttgcagtttgg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
418679 |
aagaatatcgcgtttttgtaatataggccaactcccacagactttgctcccctgctttttatcggtttccactttgttttgctcaaaacttgcagtttgg |
418580 |
T |
|
| Q |
110 |
caacaagaaaccccattaacaccttggcaacagccaaccacattttcattgttgttcagagagttactttctactgctacattattcttcttggtatca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
418579 |
caacaagaaaccccattaacaccttggcaacagccaaccacattttcattgttgttcagagagttactttctactgctacattattcttcttggtatca |
418481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 78 - 162
Target Start/End: Original strand, 397902 - 397989
Alignment:
| Q |
78 |
ccactttgttttgctcaaaacttgcagtttggcaacaagaa---accccattaacaccttggcaacagccaaccacattttcattgtt |
162 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||||||||| ||||||| ||||||||| ||||| ||||| || ||||||||||| |
|
|
| T |
397902 |
ccactttgttttgctcaaaactttgacttttgcaacaagaaaccaccccatcaacaccttgacaacaaccaacaacgttttcattgtt |
397989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 147
Target Start/End: Complemental strand, 406233 - 406193
Alignment:
| Q |
107 |
tggcaacaagaaaccccattaacaccttggcaacagccaac |
147 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
406233 |
tggccacaagaaaccccatcaacaccttggcaacaaccaac |
406193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University