View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16730_low_21 (Length: 203)
Name: NF16730_low_21
Description: NF16730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16730_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 9e-66; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 6353586 - 6353415
Alignment:
| Q |
18 |
gaaacctcaattggcgcgtcaaattcttgggggatcgagcgatttcccttaccctcgaaggggaagaaccggcagaagaaaaactaaaacaggttaggct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6353586 |
gaaacctcaattggcgcgtcaaattcttgggggatcaagcgatttcccttaccctcgaaggggaagaactggcagaagaaaaactaaaacaggttaggcc |
6353487 |
T |
 |
| Q |
118 |
acaaacacttgtgtcatattttggactaaacatgtgnnnnnnnggttgatccaaatgtttaccctgcctatg |
189 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
6353486 |
acaaacacttctgtcagattttggactaaacatgtgtttttttggttgatccaaatgtttaccctgcttatg |
6353415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 18 - 92
Target Start/End: Complemental strand, 6290494 - 6290420
Alignment:
| Q |
18 |
gaaacctcaattggcgcgtcaaattcttgggggatcgagcgatttcccttaccctcgaaggggaagaaccggcag |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6290494 |
gaaacctcaattggcgcgtcaaattcttgggggatcgagcaatttcccttaccctcgaaggggaagaaccggcag |
6290420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 124
Target Start/End: Complemental strand, 7460612 - 7460552
Alignment:
| Q |
64 |
ccttaccctcgaaggggaagaaccggcagaagaaaaactaaaacaggttaggctacaaaca |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | |||||| |||||||||| |||||| |
|
|
| T |
7460612 |
ccttaccctcgaaggggaagaaccggcagaaaaccatctaaaaaaggttaggctccaaaca |
7460552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University