View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16730_low_6 (Length: 406)
Name: NF16730_low_6
Description: NF16730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16730_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 1 - 395
Target Start/End: Original strand, 29415040 - 29415434
Alignment:
| Q |
1 |
caatttcaccacttcacttaatgattggttccttattaactattcataaggctcttattcacatttgctttataattttactgtagcagaaagaaacatg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29415040 |
caatttcaccacttcacttagtgattggttccttattaactattcataaggctcttattcacatttgccttataattttactgtagcagaaagaaacatg |
29415139 |
T |
|
| Q |
101 |
tgactctgcattgaattcacatcttccagcacaaattagagagcttgggtgactagagatcaataattgtcctacataaaaggttatgttaccatcccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29415140 |
tgactctgcattgaattcacatcttccagcacagattagagagcttgggtgattagagatcaataaatgtcctacataaaaggttatgttaccatcccat |
29415239 |
T |
|
| Q |
201 |
atatcacatgatccatgtccaaaagtttcctttgacaaactactatactaccttggattggtacaagtcttcaaggatctgaaactgaattacacctatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29415240 |
atatcacatgatccatgtccaaaagtttcctttgacaaactactatactaccttggattggtacaagtcttcaaggatctgaaactgaattacacctatc |
29415339 |
T |
|
| Q |
301 |
tctctagcaaatgtactaacggtcctagcatgtcattgtgactcttcttcattgccccggagattagagcatttttctggtatcaacattttcat |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29415340 |
tctctagcaaatgtactaacggtcctagcatgtcattgtgactcttcttcattgccctggagattagagcacttttctggtatcaacattttcat |
29415434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University