View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16731_high_20 (Length: 293)
Name: NF16731_high_20
Description: NF16731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16731_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 278
Target Start/End: Original strand, 25928924 - 25929184
Alignment:
| Q |
18 |
acatttgaattgtaaatgtgtttgttttcatgaagaggggttgagaaaggatgtactaacctttttcagctggttaagtttggtgatatcagtaaaagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25928924 |
acatttgaattgtaaatgtgtttgttttcatgaagaggggttgagaaaggatgtactaacctttttcagctggttaagtttggtgatatcagtaaaagaa |
25929023 |
T |
 |
| Q |
118 |
ggaggcagattaccaaaggtctcagaaatctcagctcgaattcgttgttgccattccggataaactgcaaggagatacattgcccaaactactgaaagag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25929024 |
ggaggcagattaccaaaggtctcagaaatctcagttcgaattcgttgttgccattccggataaactgcaaggagatacattgcccaaactactgaaagag |
25929123 |
T |
 |
| Q |
218 |
cagtggattcagaaccagcaaagtagatacttttgcagatatctataatcagttgattcat |
278 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25929124 |
cagtggactcagaaccagcaaagtagatacttttgcagatatctataatcagttggttcat |
25929184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University