View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16731_high_22 (Length: 292)
Name: NF16731_high_22
Description: NF16731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16731_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 78 - 276
Target Start/End: Original strand, 39580582 - 39580780
Alignment:
| Q |
78 |
ggttatgagaatgaggtaggatctctgccaatttaaatccctcattaatgttggtatgcagctgactgtgattattaaatgaattagttggctgattaag |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39580582 |
ggttatgagaatgaggtaggatctctgccaatttaaatccctcattaatgttggtatgcagctgactgtgattattaaatgaattagttggctgattaag |
39580681 |
T |
 |
| Q |
178 |
gttgcattttggcgccatatgagtgtatttagaaaaatacaatgggatttaaattggcagaaggcaggctagggttgcaattagggttaaaaaagttcc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39580682 |
gttgcattttggcgccatatgagtgtatttagaaaaatacaatgggatttaaattggcagaaggcaggctagggttgcaattagggttaaaaaagttcc |
39580780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 39579717 - 39579802
Alignment:
| Q |
1 |
tcattaatgagtacatatatgacaaaccaattatcaaaatatcttatgaccttgagcacacaaactagggatgttatggttatgag |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || || ||||||||||||||| |
|
|
| T |
39579717 |
tcattaatgagtacatatatgacaaaccaattatcaaaatatcttatgaccttgagcagacaaattatggctgttatggttatgag |
39579802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University