View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16731_high_24 (Length: 289)
Name: NF16731_high_24
Description: NF16731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16731_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 107 - 272
Target Start/End: Complemental strand, 37627724 - 37627559
Alignment:
| Q |
107 |
atattttaataatctgatttgttcaacttaattttcttagatttattagtctaaatcagagcttgtgtttattttgggttcctttgttgaattgtcataa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37627724 |
atattttaataatctgatttgttcaacttaattttcttagatttattagtctaaatcagagcttgtgtttattttgggttcatttgttgaattgtcataa |
37627625 |
T |
 |
| Q |
207 |
acacttggcatggacccactagatggctgttttttcctcttgaagatttgaccaaattcaaccaca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37627624 |
acacttggcatggacccactagatggctgttttttcctcttgaatatttgaccaaattcaaccaca |
37627559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 37628585 - 37628489
Alignment:
| Q |
19 |
taggttgcttgctttatgatgcatattagagttctttataaggtggtatttatagaccaacaaaatcttattttaaatctaattgaatatattttaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37628585 |
taggttgcttgctttatgatgcatattagagttctttataaggtggtatttatagaccaacaaaatcttattttaaatctaattgaatatattttaa |
37628489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University