View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16731_high_26 (Length: 279)
Name: NF16731_high_26
Description: NF16731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16731_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 14 - 268
Target Start/End: Original strand, 32772120 - 32772374
Alignment:
| Q |
14 |
cataggaatcaaagatgggttcatttgcctttgacaatttgtgaagctttgagagagtttagttgcttttttccttgtaggtcttcttgtatgtcaaatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32772120 |
cataggaatcaaagatgggttcatttgcctttgacaatatgtgaagctttgagagagtttagttgcttttttccttgtaggtcttcttgtatgtcaaatg |
32772219 |
T |
|
| Q |
114 |
aaagagacaaagaggaaaagggtagcttagaaggaagaagaggagtaagatctagtggtgaacatagtagagaaggttcatgtggagctgcatttgcaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32772220 |
aaagagacaaagaggaaaagggtagcttagaaggaagaagaggagtaagatctagtggtgaacatagtagagaaggttcatgtggagctgcatttgcaag |
32772319 |
T |
|
| Q |
214 |
atggttggtggcttatcaagatggtgatggaaaagggagagagattgaagtgatg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32772320 |
atggttggtggcttatcaagatggtgatggaaaaggaagagagattgaagtgatg |
32772374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University