View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16731_low_21 (Length: 293)

Name: NF16731_low_21
Description: NF16731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16731_low_21
NF16731_low_21
[»] chr2 (1 HSPs)
chr2 (18-278)||(25928924-25929184)


Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 278
Target Start/End: Original strand, 25928924 - 25929184
Alignment:
18 acatttgaattgtaaatgtgtttgttttcatgaagaggggttgagaaaggatgtactaacctttttcagctggttaagtttggtgatatcagtaaaagaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25928924 acatttgaattgtaaatgtgtttgttttcatgaagaggggttgagaaaggatgtactaacctttttcagctggttaagtttggtgatatcagtaaaagaa 25929023  T
118 ggaggcagattaccaaaggtctcagaaatctcagctcgaattcgttgttgccattccggataaactgcaaggagatacattgcccaaactactgaaagag 217  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25929024 ggaggcagattaccaaaggtctcagaaatctcagttcgaattcgttgttgccattccggataaactgcaaggagatacattgcccaaactactgaaagag 25929123  T
218 cagtggattcagaaccagcaaagtagatacttttgcagatatctataatcagttgattcat 278  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||    
25929124 cagtggactcagaaccagcaaagtagatacttttgcagatatctataatcagttggttcat 25929184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University