View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16731_low_35 (Length: 209)
Name: NF16731_low_35
Description: NF16731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16731_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 95 - 187
Target Start/End: Complemental strand, 1491378 - 1491286
Alignment:
| Q |
95 |
attcaacatgtcattcaatgttgaaattcctatttcctcttcatatttggcaattgcagttggaccgttttgtcaaattttattatgtctttc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
1491378 |
attcaacatgtcattcaatgttgaaattcctatttcctcttcatatttggcaattgcagttggaccgttttgtcaaattttactttgtctttc |
1491286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 45 - 165
Target Start/End: Complemental strand, 1482491 - 1482371
Alignment:
| Q |
45 |
aatgttgtgtcaggtagtttattcaatgagcaatgtgttaatggttcaccattcaacatgtcattcaatgttgaaattcctatttcctcttcatatttgg |
144 |
Q |
| |
|
||||||||||||||||||| |||||||||| || ||||| |||||||||||||||||||||||||| ||||||||||||| ||| ||||||| || | |
|
|
| T |
1482491 |
aatgttgtgtcaggtagttcattcaatgagtaagctgttactggttcaccattcaacatgtcattcattgttgaaattcctctttaatcttcatgatttg |
1482392 |
T |
 |
| Q |
145 |
caattgcagttggaccgtttt |
165 |
Q |
| |
|
||||||||| || |||||||| |
|
|
| T |
1482391 |
caattgcagctgcaccgtttt |
1482371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 174
Target Start/End: Original strand, 4154034 - 4154158
Alignment:
| Q |
52 |
tgtcaggtagtttattcaatgagcaatgtgttaatggttcaccattcaacatgtcattcaatg-ttgaaattcctatttcctcttcatatttggcaattg |
150 |
Q |
| |
|
||||||||| || ||||||| || | ||||| |||||||||||| ||||||||||||| || | | ||||||| ||| ||||||| ||| ||||||| |
|
|
| T |
4154034 |
tgtcaggtatttcattcaataagtgaggtgttgctggttcaccatttaacatgtcattcattgctggcaattcctttttattcttcatgttttgcaattg |
4154133 |
T |
 |
| Q |
151 |
cagttggaccg-ttttgtcaaattt |
174 |
Q |
| |
|
||| || | || ||||||||||||| |
|
|
| T |
4154134 |
caggtgcatcgtttttgtcaaattt |
4154158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University